Stem-loop sequence gga-mir-1456

AccessionMI0007061 (change log)
DescriptionGallus gallus miR-1456 stem-loop
Literature search

4 open access papers mention gga-mir-1456
(6 sentences)

Stem-loop
   --g    a   a cc    c     a     a      a        g  - gg  u 
5'    ucag ugg g  uggg cgaac gggaa ggacgg ggcggccc cg c  gg c
      |||| ||| |  |||| ||||| ||||| |||||| |||||||| || |  ||  
3'    aguc gcc c  gccc gcuug cccuu ccugcc cugcuggg gc g  cu g
   ucg    c   - au    a     c     c      g        -  u -a  u 
Get sequence
Deep sequencing
2543 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 44897354-44897463 [-]
intergenic
Database links

Mature sequence gga-miR-1456-5p

Accession MIMAT0007333
Previous IDsgga-miR-1456
Sequence

27 - 

gaaaggacggaggcggcccgcgc

 - 49

Get sequence
Deep sequencing2524 reads, 5 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

Mature sequence gga-miR-1456-3p

Accession MIMAT0007334
Previous IDsgga-miR-1456*
Sequence

63 - 

cggggucgucgccgucccuuc

 - 83

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).