Stem-loop sequence gga-mir-1306

AccessionMI0007057 (change log)
DescriptionGallus gallus miR-1306 stem-loop
Gene family MIPF0000531; mir-1306
Literature search

4 open access papers mention gga-mir-1306
(8 sentences)

Stem-loop
   --    c    u  ccu  a        gug  gc 
5'   ucca cacc cc   gc aacgucca   ac  a
     |||| |||| ||   || ||||||||   ||   
3'   aggu gugg gg   cg uugcaggu   ug  g
   ac    a    u  ucu  g        -aa  ga 
Get sequence
Deep sequencing
1374 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 1294136-1294204 [+]
sense
ENSGALT00000003227 ; gga-mir-1306-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-1306-5p

Accession MIMAT0026763
Sequence

4 - 

accaccuccccugcaaacguccagu

 - 28

Get sequence
Deep sequencing253 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1306-3p

Accession MIMAT0007329
Sequence

42 - 

uggacguuggcucugguggugau

 - 64

Get sequence
Deep sequencing1121 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
" Burnside et al in press ().
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).