Stem-loop sequence gga-mir-460b

AccessionMI0007055 (change log)
DescriptionGallus gallus miR-460b stem-loop
Gene family MIPF0000134; mir-460
Literature search

6 open access papers mention gga-mir-460b
(10 sentences)

Stem-loop
   cucagaucu       cgu     u       ca         ua u 
5'          ggcucua   ugucc cauugua  ugcugugug  u u
            |||||||   ||||| |||||||  |||||||||  | g
3'          ucgaggu   acagg guaacgu  gcgacacau  a c
   -------ac       aau     u       ac         gc c 
Get sequence
Deep sequencing
130974 reads, 1.24e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 2714081-2714170 [+]
intergenic
Database links

Mature sequence gga-miR-460b-5p

Accession MIMAT0007326
Sequence

22 - 

uccucauuguacaugcugugug

 - 43

Get sequence
Deep sequencing124700 reads, 5 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-460b-3p

Accession MIMAT0007327
Sequence

57 - 

cacagcgcaugcaauguggacau

 - 79

Get sequence
Deep sequencing6266 reads, 5 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).