Stem-loop sequence ptc-MIR1446c

AccessionMI0007044 (change log)
DescriptionPopulus trichocarpa miR1446c stem-loop
Gene family MIPF0000459; MIR1446
Literature search

1 open access papers mention ptc-MIR1446c
(4 sentences)

Stem-loop
        u        a u     -   ca        u ua    uucc    cu 
5' ccaac uuuucuga c cucuc ccu  acugcuau c  gagc    ugag  a
   ||||| |||||||| | ||||| |||  |||||||| |  ||||    ||||   
3' gguug aaaagacu g gaggg gga  ugacgaug g  uuug    guuc  a
        u        c -     u   ac        u uc    ---u    cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 11790900-11791004 [+]
intergenic
Database links

Mature sequence ptc-miR1446c

Accession MIMAT0006006
Sequence

9 - 

uucugaacucucucccucaa

 - 28

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).