Stem-loop sequence ptc-MIR1446b

AccessionMI0007043 (change log)
DescriptionPopulus trichocarpa miR1446b stem-loop
Gene family MIPF0000459; MIR1446
Literature search

1 open access papers mention ptc-MIR1446b
(4 sentences)

Stem-loop
        uuc          u   -    a     c  u u    ---      a 
5' ccaau   uucugaacuc cuc ccuc accgc ac c agag   guuggc c
   |||||   |||||||||| ||| |||| ||||| || | ||||   |||||| c
3' gguug   aagacuuggg gag ggag uggcg ug g ucuu   uaacug u
        uac          -   u    c     a  u -    ugu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 11669781-11669883 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR1446b
ptc-MIR477bCM000348.2: 11674627-11674711 [-]
ptc-MIR1446aCM000348.2: 11674408-11674512 [-]
ptc-MIR477aCM000348.2: 11669997-11670081 [-]
ptc-MIR1446bCM000348.2: 11669781-11669883 [-]
Database links

Mature sequence ptc-miR1446b

Accession MIMAT0006005
Sequence

9 - 

uucugaacucucucccucaa

 - 28

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).