Stem-loop sequence ptc-MIR171j

AccessionMI0007034 (change log)
DescriptionPopulus trichocarpa miR171j stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

6 open access papers mention ptc-MIR171j
(11 sentences)

Stem-loop
        ag   u  c           c      u     u  -auuu  au 
5' gaagc  aca gg gugguauugau cggcuc ucuuc gu     gc  c
   |||||  ||| || ||||||||||| |||||| ||||| ||     ||  a
3' cuucg  ugu uc cacuauaacua gccgag agaag cg     ug  g
        ca   -  u           a      c     u  cuuuu  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR171j

Accession MIMAT0005996
Sequence

70 - 

cgagccgaaucaauaucacu

 - 89

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).