Stem-loop sequence ptc-MIR171m

AccessionMI0007033 (change log)
DescriptionPopulus trichocarpa miR171m stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

6 open access papers mention ptc-MIR171m
(11 sentences)

Stem-loop
        ag   u  c           c      aucuucuguauuugcauc 
5' gaagc  aca gg gugguauugau cggcuc                  a
   |||||  ||| || ||||||||||| ||||||                   
3' cuucg  ugu uc cacuauaacua gccgag                  g
        ca   -  u           a      cagaagucgcuucuugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 2197358-2197458 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR171m
ptc-MIR171jCM000348.2: 2201526-2201626 [-]
ptc-MIR171mCM000348.2: 2197358-2197458 [-]
Database links

Mature sequence ptc-miR171m

Accession MIMAT0005995
Sequence

70 - 

cgagccgaaucaauaucacu

 - 89

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).