Stem-loop sequence osa-MIR1439

AccessionMI0007031 (change log)
DescriptionOryza sativa miR1439 stem-loop
Gene family MIPF0000344; MIR818
Literature search

4 open access papers mention osa-MIR1439
(8 sentences)

Stem-loop
      ug uuug        g       ac      c           c         c       cua        --u     cua 
5' uau  u    uuauaaau uaauacu  cuccgu ccaaaauauag cauuuuuag uaugaau   gacauugu   uuuag   u
   |||  |    |||||||| |||||||  |||||| ||||||||||| ||||||||| |||||||   ||||||||   |||||    
3' aua  g    gauguuua auuauga  gaggca gguuuuauauu guaaaaauc auacuua   cuguaaca   agauc   g
      gu uuuu        a       gu      a           c         a       aac        uac     uaa 
Get sequence
Deep sequencing
711 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 10074109-10074280 [+]
intergenic
Database links

Mature sequence osa-miR1439

Accession MIMAT0005993
Sequence

132 - 

uuuuggaacggagugaguauu

 - 152

Get sequence
Deep sequencing349 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).