Stem-loop sequence osa-MIR1441

AccessionMI0007029 (change log)
DescriptionOryza sativa miR1441 stem-loop
Literature search

4 open access papers mention osa-MIR1441
(6 sentences)

Stem-loop
          c         c       cc              c    a                                        gg 
5' guuuuuu auucguguc gaaaacu  uuuugauaucuggu aaac uucgaugugacaucuaaaaauuuucuuuucgcgaacuaag  c
   ||||||| ||||||||| |||||||  |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||   
3' caaaaaa uaagcacag cuuuugg  aaggcuguaggcca uuug aggcuacacuguggguuuuuaaaagaaaagcgcuugauuu  c
          a         a       aa              a    c                                        gu 
Get sequence
Deep sequencing
2628 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 19485741-19485920 [-]
intergenic
Database links

Mature sequence osa-miR1441

Accession MIMAT0005991
Sequence

140 - 

accggaugucggaaaagguuu

 - 160

Get sequence
Deep sequencing993 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).