Stem-loop sequence osa-MIR1440a

AccessionMI0007028 (change log)
Previous IDsosa-MIR1440
DescriptionOryza sativa miR1440 stem-loop
Gene family MIPF0001531; MIR1440
Literature search

3 open access papers mention osa-MIR1440a
(3 sentences)

Stem-loop
           a                          c    c          c                      ---    -----   c     ccc 
5' aaaugcca ugcucaaauaccacucuccuaaauuu cauu ccaaauacca ccgggcccacaugucagccuca   ucca     gca agggu   a
   |||||||| |||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||   ||||     ||| |||||    
3' uuuacggu acgaguuuauggugagaggguuuaaa guaa gguuuauggu ggcccggguguacagucggagu   aggu     ugu uuuca   c
           c                          a    u          a                      gaa    aaguu   -     cua 
Get sequence
Deep sequencing
293 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 5980506-5980694 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1440a
osa-MIR1440aChr9: 5980506-5980694 [-]
osa-MIR1440bChr9: 5980506-5980693 [+]
Database links

Mature sequence osa-miR1440a

Accession MIMAT0005990
Previous IDsosa-miR1440
Sequence

10 - 

ugcucaaauaccacucuccu

 - 29

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).