Stem-loop sequence gga-mir-1434

AccessionMI0006992 (change log)
DescriptionGallus gallus miR-1434 stem-loop
Gene family MIPF0000775; mir-1434
Literature search

2 open access papers mention gga-mir-1434
(4 sentences)

Stem-loop
   --ag     g u    -ga           c  u   cu 
5'     ugcgu a gaug   aaauuucuuca uu gac  g
       ||||| | ||||   ||||||||||| || |||  a
3'     gcgca u cuau   uuuaaagaagu ag uug  c
   ucga     g -    gag           u  u   uu 
Get sequence
Deep sequencing
372 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 1453231-1453307 [+]
sense
ENSGALT00000045049 ; EEF2-202; intron 5
ENSGALT00000002831 ; EEF2-201; intron 6
Database links

Mature sequence gga-miR-1434

Accession MIMAT0007295
Sequence

2 - 

gugcgugaugauggaaaauu

 - 21

Get sequence
Deep sequencing99 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).