Stem-loop sequence osa-MIR810b

AccessionMI0006986 (change log)
DescriptionOryza sativa miR810b stem-loop
Gene family MIPF0000497; MIR810
Literature search

5 open access papers mention osa-MIR810b
(6 sentences)

Stem-loop
   ----   c                        aaua                             c                                               c 
5'     agc caccacauguggcucgcaugcuua    acuaacggcauaauuagaucacuugauga gacguauaucgguguucgcuauauauacuaucuacugguaaguauau u
       ||| ||||||||||||||||||||||||    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| u
3'     ucg gugguguacaccgagcguacgaau    ugauugccguauuaauuuagugaacuacu cugcguauagccacaagugauauauaugauagaugaccauucauaua u
   gcau   a                        ----                             a                                               a 
Get sequence
Deep sequencing
434 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 959574-959796 [-]
intergenic
Database links

Mature sequence osa-miR810b.1

Accession MIMAT0005977
Sequence

144 - 

ugaacaccgauaugcgucauc

 - 164

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1]
Database links

Mature sequence osa-miR810b.2

Accession MIMAT0005978
Sequence

168 - 

aagugauuuaauuaugccguu

 - 188

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [2]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).