Stem-loop sequence gga-mir-22

AccessionMI0006982 (change log)
DescriptionGallus gallus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Literature search

12 open access papers mention gga-mir-22
(26 sentences)

Stem-loop
   gcucc       ccgg              -     a      u  -c  u 
5'      uggcugc    cagcaguucuucag uggca gcuuua gu  cu c
        |||||||    |||||||||||||| ||||| |||||| ||  || u
3'      accgaug    guugucaagaaguu accgu cgaaau cg  ga c
   cuugc       -uaa              g     -      -  au  u 
Get sequence
Deep sequencing
95290 reads, 940 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 5380348-5380447 [-]
intergenic
Database links

Mature sequence gga-miR-22-5p

Accession MIMAT0007287
Previous IDsgga-miR-22*
Sequence

21 - 

aguucuucaguggcaagcuuua

 - 42

Get sequence
Deep sequencing2105 reads, 5 experiments
Evidence experimental; cloned [1], Northern [3], Illumina [4]
Database links
Predicted targets

Mature sequence gga-miR-22-3p

Accession MIMAT0007288
Previous IDsgga-miR-22
Sequence

62 - 

aagcugccaguugaagaacugu

 - 83

Get sequence
Deep sequencing93161 reads, 5 experiments
Evidence experimental; cloned [1-2], Northern [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).
4
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).