Stem-loop sequence gga-mir-1416

AccessionMI0006981 (change log)
DescriptionGallus gallus miR-1416 stem-loop
Gene family MIPF0000692; mir-1426
Literature search

4 open access papers mention gga-mir-1416
(13 sentences)

Stem-loop
   u a            uuc            cgc    ccuu  u 
5'  g ggcugauacuuu   cuuaacucaugc   ugug    ua a
    | ||||||||||||   ||||||||||||   ||||    || u
3'  c cugacuaugaga   gaguugaguaug   acac    au u
   a -            cau            uua    -uuu  u 
Get sequence
Deep sequencing
6225 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 34922631-34922719 [+]
sense
ENSGALT00000024387 ; MAMDC2-201; intron 5
Database links

Mature sequence gga-miR-1416-5p

Accession MIMAT0007285
Previous IDsgga-miR-1416
Sequence

17 - 

uccuuaacucaugccgcugug

 - 37

Get sequence
Deep sequencing6087 reads, 5 experiments
Evidence experimental; cloned [1], 454 [3]
Predicted targets

Mature sequence gga-miR-1416-3p

Accession MIMAT0007286
Previous IDsgga-miR-1416*
Sequence

55 - 

acaauuguaugaguugaguaca

 - 76

Get sequence
Deep sequencing137 reads, 4 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
3
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).