Stem-loop sequence gga-mir-1329

AccessionMI0006979 (change log)
DescriptionGallus gallus miR-1329 stem-loop
Gene family MIPF0000635; mir-1329
Literature search

2 open access papers mention gga-mir-1329
(2 sentences)

Stem-loop
   ucuugg  u   ug   a    ca       c       u  auuucuc 
5'       uc ggu  uag gaua  gugauca guuacga gg       a
         || |||  ||| ||||  ||||||| ||||||| ||        
3'       ag uca  auc cuau  cacuagu cgaugcu cc       a
   ----ag  u   gu   c    ag       u       -  aacaaug 
Get sequence
Deep sequencing
60463 reads, 680 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 97355529-97355623 [+]
sense
ENSGALT00000026534 ; ATP6V1C2-201; intron 4
Database links

Mature sequence gga-miR-1329-5p

Accession MIMAT0007281
Previous IDsgga-miR-1329
Sequence

21 - 

uacagugaucacguuacgaugg

 - 42

Get sequence
Deep sequencing60158 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2], 454 [3]
Database links
Predicted targets

Mature sequence gga-miR-1329-3p

Accession MIMAT0007282
Previous IDsgga-miR-1329*
Sequence

59 - 

ccucguagcuugaucacgauau

 - 80

Get sequence
Deep sequencing199 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
3
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).