Stem-loop sequence osa-MIR444e

AccessionMI0006977 (change log)
DescriptionOryza sativa miR444e stem-loop
Gene family MIPF0000402; MIR444
Literature search

23 open access papers mention osa-MIR444e
(66 sentences)

Stem-loop
        u    c        a      a      c                 -a    c ug    -au a 
5' gguuu guaa caggggca uaagcu gaggca caacugcauaacuugcg  gaaa u  uugg   g u
   ||||| |||| |||||||| |||||| |||||| |||||||||||||||||  |||| |  ||||   | g
3' ccaaa cguu guuuccgu auucga cuccgu guugacguauugaacgc  uuuu a  aacc   c a
        u    u        c      a      c                 cg    - gu    guu u 
Get sequence
Deep sequencing
2654 reads, 1.65e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR444e

Accession MIMAT0005975
Sequence

99 - 

ugcaguugcugccucaagcuu

 - 119

Get sequence
Deep sequencing1408 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).