Stem-loop sequence osa-MIR444d

Accession MI0006976
Description Oryza sativa miR444d stem-loop
Gene family MIPF0000402; MIR444
Stem-loop 
aguuauu   cau  u    c     a       a         u             g     --        
       gca   gg ggca caagc ugaggca caacugcau acuugcaagaaag cacaa  aaucauu 
       |||   || |||| ||||| ||||||| ||||||||| ||||||||||||| |||||  |||||| a
       cgu   cc ccgu guucg acuccgu guugacgug ugaacguucuuuc guguu  uuaguag 
--uaaac   cuc  u    c     a       c         u             g     ca
Get sequence
Deep sequencing
3516 reads, 4 experiments
Comments

Morin et al identify by high throughput sequencing a product offset from miR444d.3 by 3 nts, named miR444b in [3].

Mature sequence osa-miR444d.3

Accession MIMAT0005972
Sequence

82 -  

uuguggcuuucuugcaaguug

 - 102

Get sequence
Deep sequencing 557 reads, 4 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2], 454 [3]
Validated targets

Mature sequence osa-miR444d.2

Accession MIMAT0005973
Sequence

103 -  

ugcaguugcugccucaagcuu

 - 123

Get sequence
Deep sequencing 2625 reads, 4 experiments
Evidence experimental; MPSS [1], Northern [1]

Mature sequence osa-miR444d.1

Accession MIMAT0005974
Sequence

108 -  

uugcugccucaagcuugcugc

 - 128

Get sequence
Deep sequencing 1683 reads, 4 experiments
Evidence experimental; MPSS [1], Northern [1]

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3
PMID:18323537 "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa" Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ Genome Res. 18:571-584(2008).