Stem-loop sequence osa-MIR444d

AccessionMI0006976 (change log)
DescriptionOryza sativa miR444d stem-loop
Gene family MIPF0000402; MIR444
Literature search

23 open access papers mention osa-MIR444d
(71 sentences)

Stem-loop
   aguuauu   cau  u    c     a       a         u             g     --        
5'        gca   gg ggca caagc ugaggca caacugcau acuugcaagaaag cacaa  aaucauu 
          |||   || |||| ||||| ||||||| ||||||||| ||||||||||||| |||||  |||||| a
3'        cgu   cc ccgu guucg acuccgu guugacgug ugaacguucuuuc guguu  uuaguag 
   --uaaac   cuc  u    c     a       c         u             g     ca        
Get sequence
Deep sequencing
1565 reads, 800 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Morin et al identify by high throughput sequencing a product offset from miR444d.3 by 3 nts, named miR444b in [3].

Database links

Mature sequence osa-miR444d.3

Accession MIMAT0005972
Sequence

82 - 

uuguggcuuucuugcaaguug

 - 102

Get sequence
Deep sequencing68 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2], 454 [3]
Database links

Mature sequence osa-miR444d.2

Accession MIMAT0005973
Sequence

103 - 

ugcaguugcugccucaagcuu

 - 123

Get sequence
Deep sequencing1373 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1]
Database links

Mature sequence osa-miR444d.1

Accession MIMAT0005974
Sequence

108 - 

uugcugccucaagcuugcugc

 - 128

Get sequence
Deep sequencing706 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3
PMID:18323537 "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa" Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ Genome Res. 18:571-584(2008).