Stem-loop sequence osa-MIR444c

AccessionMI0006975 (change log)
DescriptionOryza sativa miR444c stem-loop
Gene family MIPF0000402; MIR444
Literature search

25 open access papers mention osa-MIR444c
(75 sentences)

Stem-loop
   aguug   -    u              a                 u           ---      uuua 
5'      cug caag ggaggcggcaagcu gagacagcaacugcaua cuugcaagaaa   aucggu    u
        ||| |||| |||||||||||||| ||||||||||||||||| |||||||||||   ||||||    g
3'      gac guuu ccuccgucguucga cucuguuguugacgugu gaacguucuuu   uagcca    g
   ---aa   c    c              a                 c           uag      uacc 
Get sequence
Deep sequencing
6667 reads, 4e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR444c.2

Accession MIMAT0005970
Sequence

98 - 

ugcaguuguugucucaagcuu

 - 118

Get sequence
Deep sequencing3659 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]
Database links

Mature sequence osa-miR444c.1

Accession MIMAT0005971
Sequence

104 - 

uguugucucaagcuugcugcc

 - 124

Get sequence
Deep sequencing3499 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).