Stem-loop sequence osa-MIR444b

AccessionMI0006974 (change log)
DescriptionOryza sativa miR444b stem-loop
Gene family MIPF0000402; MIR444
Literature search

25 open access papers mention osa-MIR444b
(67 sentences)

Stem-loop
   -au         u   ga        u               u              ---uuuag    u 
5'    gcaagggga ggu  caagcuug ggcagcaacugcaca cuugcaagaaaauc        gguu u
      ||||||||| |||  |||||||| ||||||||||||||| ||||||||||||||        |||| u
3'    cguuucccu ccg  guucgaac cuguuguugacgugu gaacguucuuuuag        ccag c
   aac         -   uc        u               u              uagccaua    a 
Get sequence
Deep sequencing
3874 reads, 2.25e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR444b.2

Accession MIMAT0005968
Sequence

100 - 

ugcaguuguugucucaagcuu

 - 120

Get sequence
Deep sequencing3660 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1]
Database links

Mature sequence osa-miR444b.1

Accession MIMAT0005969
Sequence

106 - 

uguugucucaagcuugcugcc

 - 126

Get sequence
Deep sequencing3498 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).