Stem-loop sequence osa-MIR169r

AccessionMI0006973 (change log)
DescriptionOryza sativa miR169r stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

60 open access papers mention osa-MIR169r
(327 sentences)

Stem-loop
   --------------   ccau   c a     a    u        u  --     ca     auca      uc 
5'               agg    cuu g uagcc agga gauuugcc gu  agccc  uuguc    gcucuc  c
                 |||    ||| | ||||| |||| |||||||| ||  |||||  |||||    ||||||   
3'               ucc    gag c aucgg uccu cugaacgg ca  ucggg  aacag    cgagag  g
   acccuaucguauuc   --au   c c     c    -        u  uc     cc     ----      cu 
Get sequence
Deep sequencing
1278 reads, 750 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 35782416-35782544 [+]
intergenic
Database links

Mature sequence osa-miR169r-5p

Accession MIMAT0026762
Sequence

14 - 

uagccaaggaugauuugccug

 - 34

Get sequence
Deep sequencing1234 reads, 2 experiments
Evidence not experimental
Database links

Mature sequence osa-miR169r-3p

Accession MIMAT0005967
Sequence

86 - 

uggcaagucuccucggcuacc

 - 106

Get sequence
Deep sequencing43 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).