Stem-loop sequence osa-MIR1431

AccessionMI0006971 (change log)
DescriptionOryza sativa miR1431 stem-loop
Literature search

3 open access papers mention osa-MIR1431
(5 sentences)

Stem-loop
   --gggauucagaaagga     -----      u               c  ug    cg      g c     u   a          auaaaugaguuuauggaucgacccacuugcaucu 
5'                  aagac     uuaggg ugcaagcgggucaac cg  aacc  cuuaua g aaaau agu gguaacccgu                                  c
                    |||||     |||||| ||||||||||||||| ||  ||||  |||||| | ||||| ||| ||||||||||                                   
3'                  uucug     gauccc acguucgcccgguug gc  uugg  gaauau c uuuua uca cuauugggca                                  u
   guacgaacaauucucga     ccgua      u               a  gu    au      a a     u   -          cacaaaagugcagcaccaggcuaaacggcgugaa 
Get sequence
Deep sequencing
45 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 4766320-4766559 [-]
intergenic
Database links

Mature sequence osa-miR1431

Accession MIMAT0005965
Sequence

185 - 

uuugcgaguuggcccgcuugc

 - 205

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).