Stem-loop sequence osa-MIR1430

AccessionMI0006970 (change log)
DescriptionOryza sativa miR1430 stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

6 open access papers mention osa-MIR1430
(8 sentences)

Stem-loop 
          gauug -    g       a   u    ug  u    -   c     g        -   -    -a a 
5' augagga     c cucu uuagcca gaa ggcu  cc aucu cca uauuu guucauca cug gaac  c c
   |||||||     | |||| ||||||| ||| ||||  || |||| ||| ||||| |||||||| ||| ||||  |  
3' uacucuu     g gaga aaucggu cuu ccga  gg uaga ggu auaaa uagguggu gac cuug  g u
          ----a u    g       c   -    gu  -    a   -     g        a   u    gg u
Get sequence
Deep sequencing
250 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 6825011-6825152 [-]
intergenic
Database links

Mature sequence osa-miR1430

Accession MIMAT0005964
Sequence

108 -  

uggugagccuuccuggcuaag

 - 128

Get sequence
Deep sequencing23 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2]

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).