Stem-loop sequence osa-MIR1429

AccessionMI0006969 (change log)
DescriptionOryza sativa miR1429 stem-loop
Literature search

6 open access papers mention osa-MIR1429
(8 sentences)

Stem-loop
            u          u   u        ------------uu     u   -      gug 
5' guaauauac aauccgugca cca cguauauc              acacg cau gugaac   c
   ||||||||| |||||||||| ||| ||||||||              ||||| ||| ||||||    
3' cguuguaug uugggcacgu ggu guguaugg              ugugu gua uacuug   a
            u          u   -        uaauuguaaauauu     u   a      gcu 
Get sequence
Deep sequencing
577 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 2036953-2037072 [-]
intergenic
Database links

Mature sequence osa-miR1429-5p

Accession MIMAT0009208
Sequence

1 - 

guaauauacuaauccgugcau

 - 21

Get sequence
Deep sequencing75 reads, 2 experiments
Evidence experimental; Illumina [3-4]
Database links

Mature sequence osa-miR1429-3p

Accession MIMAT0005963
Previous IDsosa-miR1429
Sequence

99 - 

guugcacggguuuguauguug

 - 119

Get sequence
Deep sequencing502 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2], Illumina [4]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
4
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).