Stem-loop sequence osa-MIR1425

AccessionMI0006965 (change log)
DescriptionOryza sativa miR1425 stem-loop
Literature search

15 open access papers mention osa-MIR1425
(59 sentences)

Stem-loop
             c           auc         -  --a         ua 
5' cuguugacug auuaggauuca   cuugcugcu aa   uguauugcu  u
   |||||||||| |||||||||||   ||||||||| ||   |||||||||  a
3' gauagcugau uaauucuaggu   gaacgacga uu   auauaacga  u
             a           caa         c  gua         cu 
Get sequence
Deep sequencing
1797 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 8862149-8862250 [+]
intergenic
Database links

Mature sequence osa-miR1425-5p

Accession MIMAT0005959
Previous IDsosa-miR1425
Sequence

14 - 

uaggauucaauccuugcugcu

 - 34

Get sequence
Deep sequencing1599 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2-3]
Database links

Mature sequence osa-miR1425-3p

Accession MIMAT0020933
Sequence

71 - 

cagcaagaacuggaucuuaau

 - 91

Get sequence
Deep sequencing198 reads, 2 experiments
Evidence experimental; Illumina [4]
Database links

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).
4
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).