Stem-loop sequence osa-MIR1423

AccessionMI0006963 (change log)
Previous IDsosa-MIR1423
DescriptionOryza sativa miR1423 stem-loop
Literature search

4 open access papers mention osa-MIR1423
(8 sentences)

Stem-loop 
        a   u                    a    -             a        -     -c  g 
5' gcaca cac aguauuugggaggcaacuac cguu gggcgcucgaucc gggguggg aaaau  gg c
   ||||| ||| |||||||||||||||||||| |||| ||||||||||||| |||||||| |||||  ||  
3' cgugu gug ucauaaacccucuguugaug gcga cccgcgagcuagg ccccaccc uuuug  cc g
        c   u                    -    a             c        c     ca  c
Get sequence
Deep sequencing
1270 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 19715117-19715252 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1423
osa-MIR1423Chr4: 19715117-19715252 [+]
osa-MIR1868Chr4: 19715448-19715616 [+]
Database links

Mature sequence osa-miR1423-5p

Accession MIMAT0015244
Previous IDsosa-miR1423-5p.2
Sequence

21 -  

aggcaacuacacguugggcgcucg

 - 44

Get sequence
Deep sequencing867 reads, 2 experiments
Evidence experimental; Illumina [3], 454 [4]
Database links

Mature sequence osa-miR1423-3p

Accession MIMAT0005957
Previous IDsosa-miR1423
Sequence

95 -  

agcgcccaagcgguaguuguc

 - 115

Get sequence
Deep sequencing369 reads, 2 experiments
Evidence experimental; MPSS [1], Northern [1], cloned [2], Illumina [3]

References

1
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
2
PMID:18312648 "Identification of novel and candidate miRNAs in rice by high throughput sequencing" Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK BMC Plant Biol. 8:25(2008).
3
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
4
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).