Stem-loop sequence oan-mir-873

AccessionMI0006956 (change log)
DescriptionOrnithorhynchus anatinus miR-873 stem-loop
Gene family MIPF0000390; mir-873
Stem-loop
            u ca   g a      ug g       ua  ga 
5' aaguuugug g  uuu c ggaacu  u agucucc  uu  a
   ||||||||| |  ||| | ||||||  | |||||||  ||  a
3' uuuaaacac c  aag g ccuuga  g ucagagg  aa  a
            c ac   g c      gu g       gc  gu 
Get sequence
Deep sequencing
1538 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X5: 21961543-21961629 [+]
intergenic
Database links

Mature sequence oan-miR-873-5p

Accession MIMAT0007272
Previous IDsoan-miR-873
Sequence

16 - 

ugcaggaacuugugagucucc

 - 36

Get sequence
Deep sequencing1470 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-873-3p

Accession MIMAT0007273
Previous IDsoan-miR-873*
Sequence

53 - 

gagacuggugaguucccgggaa

 - 74

Get sequence
Deep sequencing67 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).