Stem-loop sequence oan-mir-101-2

AccessionMI0006955 (change log)
DescriptionOrnithorhynchus anatinus miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucacgguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     g
     gu  u                    a -    aaagu 
Get sequence
Deep sequencing
960647 reads, 1.48e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig154298: 207-285 [-]
sense
X5: 11280458-11280536 [+]
sense
Database links

Mature sequence oan-miR-101

Accession MIMAT0007011
Sequence

49 - 

uacaguacugugauaacugaag

 - 70

Get sequence
Deep sequencing1920770 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).