Stem-loop sequence oan-mir-1413

AccessionMI0006933 (change log)
DescriptionOrnithorhynchus anatinus miR-1413 stem-loop
Stem-loop
       --           - -    a c     g c      ---c  u 
5' gccg  cggggcggccg g aggg c ccagc c cggcac    gc c
   ||||  ||||||||||| | |||| | ||||| | ||||||    || c
3' cggc  guccugccggc c uucc g ggucg g gccgug    ug c
       ca           g a    - a     a c      uccc  u 
Get sequence
Deep sequencing
96 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 29292974-29293064 [-]
sense
ENSOANT00000003627 ; oan-mir-1413-201; exon 19
Database links

Mature sequence oan-miR-1413-5p

Accession MIMAT0026761
Sequence

16 - 

gagggaccccagcgcccggcacc

 - 38

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1413-3p

Accession MIMAT0007233
Sequence

53 - 

ugccgcgagcuggagccuuacg

 - 74

Get sequence
Deep sequencing91 reads, 5 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).