Stem-loop sequence oan-mir-146a

AccessionMI0006931 (change log)
DescriptionOrnithorhynchus anatinus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ---------uucaacuuggagauuca    g      u ug        a          -   g uug 
5'                           guac cucagc u  agaacuga uuccacgggu ugu a   c
                             |||| |||||| |  |||||||| |||||||||| ||| |   a
3'                           caug gggucg a  ucuugacu ggggugccca aca u   a
   aagaggaccuaagacgcuccugucuc    -      - gu        c          g   g cuc 
Get sequence
Deep sequencing
25473 reads, 480 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 22404743-22404871 [-]
intergenic
Database links

Mature sequence oan-miR-146a-5p

Accession MIMAT0007230
Previous IDsoan-miR-146a
Sequence

31 - 

ugagaacugaauuccacggguu

 - 52

Get sequence
Deep sequencing25396 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-146a-3p

Accession MIMAT0007231
Previous IDsoan-miR-146a*
Sequence

72 - 

acccguggggcucaguucuuga

 - 93

Get sequence
Deep sequencing76 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).