Stem-loop sequence oan-mir-103-1

AccessionMI0006930 (change log)
DescriptionOrnithorhynchus anatinus miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   cuugaacuguaaacaugug      --u -   cu       --    u  u           c   u g a 
5'                    gaagau   g cuc  ugcccuc  ggcu cu uacagugcugc uug u c u
                      ||||||   | |||  |||||||  |||| || ||||||||||| ||| | |  
3'                    cuucua   c gag  acgggag  ucgg ga auguuacgacg aac a g a
   ---------------gaaa      uuu a   uu       ua    -  c           -   u g u 
Get sequence
Deep sequencing
498371 reads, 7.38e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 17065005-17065128 [+]
sense
ENSOANT00000012443 ; PANK3-201; intron 5
Database links

Mature sequence oan-miR-103-1-5p

Accession MIMAT0031098
Sequence

38 - 

ucggcuucuuuacagugcugccuug

 - 62

Get sequence
Deep sequencing91 reads, 4 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-103-3p

Accession MIMAT0006942
Previous IDsoan-miR-103
Sequence

77 - 

agcagcauuguacagggcuauga

 - 99

Get sequence
Deep sequencing996775 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).