Stem-loop sequence oan-mir-7-1

AccessionMI0006926 (change log)
DescriptionOrnithorhynchus anatinus miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   gccuguagaauauauagaagauuucagu  a   u     a  u        a     a       u      --ug   a 
5'                             gg cgu ggucu gu cugugugg agacu gugauuu guuguu    uag u
                               || ||| ||||| || |||||||| ||||| ||||||| ||||||    |||  
3'                             cc gua ccaga ca gguauacc ucuga cgcuaaa caacag    auc a
   ------------------caggacaucu  -   -     -  c        g     -       -      cuaa   a 
Get sequence
Deep sequencing
19814 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra666: 6521-6659 [-]
sense
ENSOANT00000023021 ; HNRNPK-201; intron 14
Database links

Mature sequence oan-miR-7-5p

Accession MIMAT0006986
Previous IDsoan-miR-7
Sequence

50 - 

uggaagacuagugauuuuguugu

 - 72

Get sequence
Deep sequencing51632 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-7-1-3p

Accession MIMAT0009195
Previous IDsoan-miR-7-1*
Sequence

92 - 

caacaaaucgcagucugccaua

 - 113

Get sequence
Deep sequencing1830 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).