Stem-loop sequence oan-mir-1398

AccessionMI0006909 (change log)
DescriptionOrnithorhynchus anatinus miR-1398 stem-loop
Stem-loop
   ------------uggcaaaa      cu   a cc     -   a  u       gga  u 
5'                     uccauc  cuc g  ccuuu guc au acacugc   gc a
                       ||||||  ||| |  ||||| ||| || |||||||   ||  
3'                     agguag  gag c  ggaga cag ug ugugacg   cg g
   acuggguagaaagggcuuca      ag   c -a     u   c  u       --a  g 
Get sequence
Deep sequencing
209 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra462: 3184108-3184215 [-]
sense
Clustered miRNAs
< 10kb from oan-mir-1398
oan-mir-1398Ultra462: 3184108-3184215 [-]
oan-mir-1397Ultra462: 3183184-3183299 [-]
Database links

Mature sequence oan-miR-1398-5p

Accession MIMAT0007201
Sequence

22 - 

ccccuuugucaauuacacugc

 - 42

Get sequence
Deep sequencing125 reads, 4 experiments
Evidence experimental; Illumina [1-2]

Mature sequence oan-miR-1398-3p

Accession MIMAT0026760
Sequence

57 - 

aguguugucgacuagaggaccg

 - 78

Get sequence
Deep sequencing45 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).