Stem-loop sequence oan-mir-1395

AccessionMI0006906 (change log)
DescriptionOrnithorhynchus anatinus miR-1395 stem-loop
Stem-loop
     -   -   ----u -   g  ua        c   c         cu      -a  u 
5' cg cag cca     c guu cc  gccccagc gaa uggccuuuc  gggccg  ac c
   || ||| |||     | ||| ||  |||||||| ||| |||||||||  ||||||  || c
3' gc guc ggu     g cag gg  cggggucg cuu aucgggaag  ccuggu  ug a
     a   a   uccuu a   -  gc        c   a         -u      ag  a 
Get sequence
Deep sequencing
1088 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra46: 184818-184930 [-]
intergenic
Database links

Mature sequence oan-miR-1395-5p

Accession MIMAT0026759
Sequence

25 - 

gccgaacuggccuuuccugggcc

 - 47

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1395-3p

Accession MIMAT0007197
Sequence

64 - 

uccugaagggcuaauuccgcu

 - 84

Get sequence
Deep sequencing1083 reads, 2 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).