Stem-loop sequence oan-mir-302-1

AccessionMI0006904 (change log)
DescriptionOrnithorhynchus anatinus miR-302-1 stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   acgugaagguaguuuguaaauuugauuucagggcucccug     u         uaa          c 
5'                                         ucacu aaacgugga   acuugcuuua u
                                           ||||| |||||||||   ||||||||||  
3'                                         aguga uuuguaccu   ugaaugaaau u
   --------------uguagcuucuuuaaaaccauuguggu     u         ucg          u 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra445: 3003013-3003138 [-]
antisense
ENSOANT00000014798 ; LARP7-201; intron 7
Clustered miRNAs
< 10kb from oan-mir-302-1
oan-mir-302-2Ultra445: 3003429-3003497 [-]
oan-mir-302-1Ultra445: 3003013-3003138 [-]
Database links

Mature sequence oan-miR-302-3p

Accession MIMAT0007195
Previous IDsoan-miR-302
Sequence

78 - 

uaagugcuuccauguuuuagu

 - 98

Get sequence
Deep sequencing86 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).