Stem-loop sequence oan-mir-135a

AccessionMI0006902 (change log)
DescriptionOrnithorhynchus anatinus miR-135a stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   ugaucaa   aaa     ucua                u            u g a 
5'        gau   uucac    guguuuuauggcuuuu auuccuauguga a u a
          |||   |||||    |||||||||||||||| |||||||||||| | | u
3'        cua   aagug    cauaaaguaccgaagg uagggauguacu u a a
   ---acua   -aa     -uua                -            c g a 
Get sequence
Deep sequencing
18666 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra443: 6813027-6813135 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-135a
oan-mir-135aUltra443: 6813027-6813135 [-]
oan-mir-7430Ultra443: 6812403-6812458 [-]
Database links

Mature sequence oan-miR-135a-3p

Accession MIMAT0007193
Previous IDsoan-miR-135a
Sequence

67 - 

auguagggauggaagccauga

 - 87

Get sequence
Deep sequencing1404 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).