Stem-loop sequence oan-mir-383

AccessionMI0006900 (change log)
DescriptionOrnithorhynchus anatinus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
           aau  c gag    c     -c  a      aa    a        --    gu 
5' cgcaagag   cu g   ucac ugcuc  uc gaucag  ggug uuguggcu  uugg  a
   ||||||||   || |   |||| |||||  || ||||||  |||| ||||||||  ||||  g
3' guguuuuc   ga c   ggug acgag  ag cugguc  ucac aacaccga  aauc  c
           --c  a --a    a     aa  a      cg    -        cg    au 
Get sequence
Deep sequencing
10489 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra442: 556353-556471 [-]
intergenic
Database links

Mature sequence oan-miR-383-5p

Accession MIMAT0007189
Previous IDsoan-miR-383
Sequence

31 - 

cagaucagaaggugauuguggc

 - 52

Get sequence
Deep sequencing10365 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-383-3p

Accession MIMAT0007190
Previous IDsoan-miR-383*
Sequence

73 - 

ccacaacacugccuggucaga

 - 93

Get sequence
Deep sequencing52 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).