Stem-loop sequence oan-mir-802

AccessionMI0006896 (change log)
DescriptionOrnithorhynchus anatinus miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
     uu     uc     g     a          a       -  cc 
5' gu  cuguu  uugca ucagu acaaagauuc uccuugu gu  u
   ||  |||||  ||||| ||||| |||||||||| ||||||| ||  g
3' cg  gguaa  aacgu aguca uguuucuggg agggaca cg  u
     gu     uu     g     c          -       a  aa 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra41: 436687-436779 [-]
intergenic
Database links

Mature sequence oan-miR-802-5p

Accession MIMAT0007181
Previous IDsoan-miR-802
Sequence

18 - 

ucaguaacaaagauucauccuugu

 - 41

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-802-3p

Accession MIMAT0007182
Previous IDsoan-miR-802*
Sequence

56 - 

agggagggucuuugucacuga

 - 76

Get sequence
Deep sequencing32 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).