Stem-loop sequence oan-mir-1389

AccessionMI0006891 (change log)
DescriptionOrnithorhynchus anatinus miR-1389 stem-loop
Stem-loop
      aau     ----ga    -    u    -     cg        a   c  agu  ug 
5' cgg   uggcc      uccc ggcu guuc cucgg  uuuccggc cgg ca   ga  c
   |||   |||||      |||| |||| |||| |||||  |||||||| ||| ||   ||   
3' gcc   acugg      aggg ccgg caag gagcu  aaaggucg guc gu   cu  g
      --g     accucg    a    u    u     -a        g   a  ---  uu 
Get sequence
Deep sequencing
160 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra341: 9461664-9461775 [+]
intergenic
Database links

Mature sequence oan-miR-1389-5p

Accession MIMAT0026758
Sequence

26 - 

ccucggcguuuccggcacggcca

 - 48

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-1389-3p

Accession MIMAT0007174
Sequence

64 - 

acugggcuggaaaaucgaguga

 - 85

Get sequence
Deep sequencing159 reads, 5 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).