Stem-loop sequence oan-mir-199

AccessionMI0006890 (change log)
DescriptionOrnithorhynchus anatinus miR-199 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   uagaag  u   gaga    -    c   gcc       u        c   ---u   ga 
5'       cg ccg    uccu gcuc guc   ccagugu cagacuac ugu    cag  c
         || |||    |||| |||| |||   ||||||| |||||||| |||    |||  a
3'       gc ggc    ggga cggg cag   gguuaca gucugaug aca    guc  a
   -guaaa  -   gaaa    a    u   auu       c        -   uguu   gu 
Get sequence
Deep sequencing
28415 reads, 780 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra341: 2337896-2338013 [-]
antisense
ENSOANT00000001414 ; DNM3-201; intron 13
Clustered miRNAs
< 10kb from oan-mir-199
oan-mir-199Ultra341: 2337896-2338013 [-]
oan-mir-214Ultra341: 2331532-2331649 [-]
Database links

Mature sequence oan-miR-199-5p

Accession MIMAT0007172
Previous IDsoan-miR-199*
Sequence

31 - 

cccaguguucagacuaccuguu

 - 52

Get sequence
Deep sequencing2831 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-199-3p

Accession MIMAT0007173
Previous IDsoan-miR-199
Sequence

70 - 

acaguagucugcacauugguu

 - 90

Get sequence
Deep sequencing25577 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).