Stem-loop sequence oan-mir-16a

AccessionMI0006887 (change log)
DescriptionOrnithorhynchus anatinus miR-16a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   -------------cacugugaucucauu      ag   c          -  a        c uuaag   c 
5'                             gucagc  uac uuagcagcac gu aauauugg g     acu u
                               ||||||  ||| |||||||||| || |||||||| |     ||| a
3'                             cagucg  aug agucgucgug ca uuaugacc c     uga a
   gugaaaacuaacagucaacaucucucau      ga   a          u  g        u ---ua   a 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra336: 5246345-5246476 [+]
Clustered miRNAs
< 10kb from oan-mir-16a
oan-mir-15aUltra336: 5246216-5246313 [+]
oan-mir-16aUltra336: 5246345-5246476 [+]
Database links

Mature sequence oan-miR-16a-5p

Accession MIMAT0007166
Previous IDsoan-miR-16a

29 - 


 - 50

Get sequence
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-16a-3p

Accession MIMAT0007167
Previous IDsoan-miR-16a*

71 - 


 - 92

Get sequence
Evidence experimental; Illumina [1]


PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).