Stem-loop sequence oan-mir-16a

AccessionMI0006887 (change log)
DescriptionOrnithorhynchus anatinus miR-16a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -------------cacugugaucucauu      ag   c          -  a        c uuaag   c 
5'                             gucagc  uac uuagcagcac gu aauauugg g     acu u
                               ||||||  ||| |||||||||| || |||||||| |     ||| a
3'                             cagucg  aug agucgucgug ca uuaugacc c     uga a
   gugaaaacuaacagucaacaucucucau      ga   a          u  g        u ---ua   a 
Get sequence
Deep sequencing
364653 reads, 6.42e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra336: 5246345-5246476 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-16a
oan-mir-15aUltra336: 5246216-5246313 [+]
oan-mir-16aUltra336: 5246345-5246476 [+]
Database links

Mature sequence oan-miR-16a-5p

Accession MIMAT0007166
Previous IDsoan-miR-16a
Sequence

29 - 

uagcagcacguaaauauuggcg

 - 50

Get sequence
Deep sequencing363237 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-16a-3p

Accession MIMAT0007167
Previous IDsoan-miR-16a*
Sequence

71 - 

ccaguauugacugugcugcuga

 - 92

Get sequence
Deep sequencing1398 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).