Stem-loop sequence oan-mir-15a

AccessionMI0006886 (change log)
DescriptionOrnithorhynchus anatinus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
        -  ---     ggguaaa ua        ua          ag u 
5' gaaga ca   ccuug       g  gcagcaca  augguuugug  u u
   ||||| ||   |||||       |  ||||||||  ||||||||||  |  
3' cuucu gu   ggaac       c  cgucgugu  uaccggacau  a u
        a  cua     auaaaaa uc        ua          aa g 
Get sequence
Deep sequencing
6102 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra336: 5246216-5246313 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-15a
oan-mir-15aUltra336: 5246216-5246313 [+]
oan-mir-16aUltra336: 5246345-5246476 [+]
Database links

Mature sequence oan-miR-15a-5p

Accession MIMAT0007164
Previous IDsoan-miR-15a
Sequence

21 - 

uagcagcacauaaugguuugu

 - 41

Get sequence
Deep sequencing6094 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-15a-3p

Accession MIMAT0007165
Previous IDsoan-miR-15a*
Sequence

55 - 

caggccauauugugcugccuca

 - 76

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).