Stem-loop sequence oan-mir-133c

Accession MI0006877
Description Ornithorhynchus anatinus miR-133c stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      c g      g       ca  a  a         ccuc 
guuggc a cugcug ggcuggu  aa gg accagaucg    u
|||||| | |||||| |||||||  || || |||||||||     
cggccg u ggcgac ucggcca  uu cc ugguuuagu    c
      u g      g       ac  c  c         ccac 
Get sequence
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra299: 214696-214785 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-133c
oan-mir-1b Ultra299: 214301-214362 [+]
oan-mir-133c Ultra299: 214696-214785 [+]
Database links

Mature sequence oan-miR-133c

Accession MIMAT0007150
Sequence

54 - 

uuugguccccuucaaccggcug

 - 75

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).