Stem-loop sequence oan-mir-1b

AccessionMI0006876 (change log)
DescriptionOrnithorhynchus anatinus miR-1b stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   --           c    gc      ---  ag 
5'   acacacuucuu auau  ccauag   gg  c
     ||||||||||| ||||  ||||||   ||   
3'   ugugugaagaa ugua  gguauc   cc  u
   ug           u    -a      aag  cg 
Get sequence
Deep sequencing
10787 reads, 160 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra299: 214301-214362 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1b
oan-mir-1bUltra299: 214301-214362 [+]
oan-mir-133cUltra299: 214696-214785 [+]
Database links

Mature sequence oan-miR-1b

Accession MIMAT0007149
Sequence

41 - 

uggaauguuaagaagugugugu

 - 62

Get sequence
Deep sequencing10787 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).