Stem-loop sequence oan-mir-20a-2

AccessionMI0006874 (change log)
DescriptionOrnithorhynchus anatinus miR-20a-2 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---------cugaugacagcuccuguagcacua                 g   -  uu 
5'                                  aagugcuuauagugcag uag ug  u
                                    ||||||||||||||||| ||| ||   
3'                                  uucacgaguauuacguc auc au  a
   gacuuccacuucgagaugucggucguccugaaa                 -   u  ug 
Get sequence
Deep sequencing
44705 reads, 680 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra284: 6728615-6728723 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-20a-2
oan-mir-17Ultra284: 6728095-6728179 [+]
oan-mir-19aUltra284: 6728409-6728548 [+]
oan-mir-20a-2Ultra284: 6728615-6728723 [+]
oan-mir-19b-2Ultra284: 6728772-6728832 [+]
oan-mir-92a-2Ultra284: 6728858-6728967 [+]
oan-mir-17Ultra284: 6730992-6731076 [+]
Database links

Mature sequence oan-miR-20a-5p

Accession MIMAT0007145
Previous IDsoan-miR-20a
Sequence

23 - 

uaaagugcuuauagugcagg

 - 42

Get sequence
Deep sequencing80978 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-20a-2-3p

Accession MIMAT0009169
Previous IDsoan-miR-20a-2*
Sequence

59 - 

acugcauuaugagcacuuaaagu

 - 81

Get sequence
Deep sequencing90 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).