Stem-loop sequence oan-mir-31

AccessionMI0006853 (change log)
DescriptionOrnithorhynchus anatinus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   -----------------------------------------------cucagagcuggagagaa     g             -u   gag 
5'                                                                 ggcaa auguuggcauagc  guu   u
                                                                   ||||| |||||||||||||  |||    
3'                                                                 cuguu uacagccguaucg  caa   u
   gagucauuugucuucucuaucccucuuaauuucgaccgguaccgacgacuaucuguucuuucua     g             uc   gaa 
Get sequence
Deep sequencing
16132 reads, 220 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig9317: 1749-1884 [+]
intergenic
Database links

Mature sequence oan-miR-31-5p

Accession MIMAT0007111
Previous IDsoan-miR-31
Sequence

17 - 

aggcaagauguuggcauagcugu

 - 39

Get sequence
Deep sequencing15548 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-31-3p

Accession MIMAT0007112
Previous IDsoan-miR-31*
Sequence

53 - 

ugcuaugccgacauguugucau

 - 74

Get sequence
Deep sequencing578 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).