Stem-loop sequence oan-mir-23a

AccessionMI0006824 (change log)
DescriptionOrnithorhynchus anatinus miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   u        cg cu gg        ug   c      cu  u 
5'  gccgccgg  g  g  guuccugg  aug gauuuu  ug g
    ||||||||  |  |  ||||||||  ||| ||||||  ||  
3'  cggcgguc  c  c  uagggacc  uac cuaaaa  gc c
   g        aa -- uu        gu   a      cc  u 
Get sequence
Deep sequencing
41499 reads, 500 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig6812: 2753-2836 [+]
intergenic
Contig6812: 3296-3379 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-23a
oan-mir-23aContig6812: 2753-2836 [+]
oan-mir-23aContig6812: 3296-3379 [+]
oan-mir-27aContig6812: 3490-3574 [+]
oan-mir-24-2Contig6812: 3735-3794 [+]
Database links

Mature sequence oan-miR-23a-5p

Accession MIMAT0007060
Previous IDsoan-miR-23a*
Sequence

15 - 

gggguuccuggugaugcgauuu

 - 36

Get sequence
Deep sequencing61 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-23a-3p

Accession MIMAT0007061
Previous IDsoan-miR-23a
Sequence

53 - 

aucacauugccagggauuucca

 - 74

Get sequence
Deep sequencing41436 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).