Stem-loop sequence oan-mir-181c

AccessionMI0006823 (change log)
DescriptionOrnithorhynchus anatinus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --    gaaa       aucaa       ua   u         gugaua 
5'   uguu    agucaca     cauucau  cug cgguggguu      a
     ||||    |||||||     |||||||  ||| |||||||||      a
3'   acgg    ucggugu     guaagua  gac gccacucaa      u
   gu    ---a       -cacc       --   c         aaaaag 
Get sequence
Deep sequencing
334502 reads, 5.12e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig65528: 2622-2716 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-181c
oan-mir-181a-3Contig65528: 2999-3061 [-]
oan-mir-181cContig65528: 2622-2716 [-]
Database links

Mature sequence oan-miR-181c-5p

Accession MIMAT0007058
Previous IDsoan-miR-181c
Sequence

19 - 

aacauucauuacugucggugggu

 - 41

Get sequence
Deep sequencing334411 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-181c-3p

Accession MIMAT0007059
Previous IDsoan-miR-181c*
Sequence

60 - 

cucaccgccagaugaaugcca

 - 80

Get sequence
Deep sequencing91 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).