Stem-loop sequence oan-mir-16b

AccessionMI0006819 (change log)
DescriptionOrnithorhynchus anatinus miR-16b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
      -   -ua           cu         ua        u  ag   a 
5' cug aca   cuuauuacgcu  agcagcacg  aauauugg gu  uga g
   ||| |||   |||||||||||  |||||||||  |||||||| ||  |||  
3' gac ugu   ggauagugcga  ucgucgugu  uuauaacc ca  auu u
      g   uag           uu         ua        c  -a   c 
Get sequence
Deep sequencing
362805 reads, 6.4e+03 reads per million, 5 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig5755: 7980-8080 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-16b
oan-mir-15bContig5755: 7815-7944 [+]
oan-mir-16bContig5755: 7980-8080 [+]
Database links

Mature sequence oan-miR-16b-5p

Accession MIMAT0007052
Previous IDsoan-miR-16b
Sequence

21 - 

uagcagcacguaaauauuggug

 - 42

Get sequence
Deep sequencing362774 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-16b-3p

Accession MIMAT0007053
Previous IDsoan-miR-16b*
Sequence

59 - 

cccaauauuauugugcugcu

 - 78

Get sequence
Deep sequencing30 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).