Stem-loop sequence oan-mir-15b

AccessionMI0006818 (change log)
DescriptionOrnithorhynchus anatinus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   aauccug     ----     --------       cug   u       c  c          ---   u 
5'        caugu    ggagg        ccuugga   cua agcagca au augguuugca   ugg a
          |||||    |||||        |||||||   ||| ||||||| || ||||||||||   ||| u
3'        guaca    uuucc        ggaauuu   gau ucgucgu ua uacuaagcgu   acc a
   uuauucg     gaac     aaagaaaa       aaa   u       u  u          aga   g 
Get sequence
Deep sequencing
8874 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig5755: 7815-7944 [+]
intergenic
Clustered miRNAs
< 10kb from oan-mir-15b
oan-mir-15bContig5755: 7815-7944 [+]
oan-mir-16bContig5755: 7980-8080 [+]
Database links

Mature sequence oan-miR-15b-5p

Accession MIMAT0007050
Previous IDsoan-miR-15b
Sequence

31 - 

uagcagcacaucaugguuugc

 - 51

Get sequence
Deep sequencing8850 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-15b-3p

Accession MIMAT0007051
Previous IDsoan-miR-15b*
Sequence

69 - 

cgaaucauuauuugcugcuuu

 - 89

Get sequence
Deep sequencing20 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).