Stem-loop sequence oan-mir-33b

AccessionMI0006811 (change log)
DescriptionOrnithorhynchus anatinus miR-33b stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
     u  c a    c         a uu        cguu    c 
5' gu gg c cugu gugcauugu g  gcauugca    ccgg a
   || || | |||| ||||||||| |  ||||||||    |||| g
3' cg cc g gaca uacgugaca c  uguaacgu    gguc u
     c  a a    u         c cu        ----    a 
Get sequence
Deep sequencing
3529 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig5096: 6920-7004 [-]
sense
ENSOANT00000003906 ; SREBF2-201; intron 19
Database links

Mature sequence oan-miR-33-5p

Accession MIMAT0006817
Sequence

14 - 

gugcauuguaguugcauug

 - 32

Get sequence
Deep sequencing6940 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-33b-3p

Accession MIMAT0009191
Sequence

54 - 

caauguucccacagugcauu

 - 73

Get sequence
Deep sequencing44 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).